Sequence ID | >WENV180042422 |
Genome ID | LQAE01018177 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 190 |
End posion on genome | 265 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atctaacatt |
tRNA gene sequence |
GGAGCTATAGCAAAGCTGGTAATGCCCCGGATTGCAAATCCGGTATGCGTTGGTTCGAGT |
Downstream region at tRNA end position |
ttttcataga |
Secondary structure (Cloverleaf model) | >WENV180042422 Cys GCA t TCCA ttttcataga G - C G - C A - T G - C C - G T - A A - T T G T C A G C C A C G A A | | + | | G T A A C G G T T G G C G | | | T T G A T G C T A C TATGC C - G C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |