Sequence ID | >WENV180042438 |
Genome ID | LQAF01000007 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 32023 |
End posion on genome | 32107 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgttatgccg |
tRNA gene sequence |
GCCGAAGTGGTGGAATAGGTAGACACGCACGCTTGAGGGGCGTGTGGGGAGACCCGTGGG |
Downstream region at tRNA end position |
aaatttgaca |
Secondary structure (Cloverleaf model) | >WENV180042438 Leu GAG g ACCA aaatttgaca G - C C - G C - G G - C A - T A - T G - C T A T C C C T C A T A A G | | | | | A A G G T G G G G A G C G | | | T T G A C A C T A G G TGGGGAGACCCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |