Sequence ID | >WENV180042500 |
Genome ID | LQAF01000489 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3840 |
End posion on genome | 3913 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttcggttga |
tRNA gene sequence |
CGGGGTGTTGCCTAGTGGCTAAGGCGCCTGCTTTGGGAGCAGGAGATCGGAGGTTCGAGT |
Downstream region at tRNA end position |
tttctatcat |
Secondary structure (Cloverleaf model) | >WENV180042500 Pro TGG a ACtt tttctatcat C - G G - C G - C G - C G - C T - A G - C T G T T C T C C A T G A T + | | | | G G T C C G G G A G G C G | | | | T T C A G G C T A G AGATC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |