Sequence ID | >WENV180042503 |
Genome ID | LQAF01000514 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2224 |
End posion on genome | 2150 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
taaccacaat |
tRNA gene sequence |
GCCCCCGTAGCTCAGTGGATAGAGCATAGGATTCCTAATCCTTGTGCGCAGGTTCGATTC |
Downstream region at tRNA end position |
tgataatggg |
Secondary structure (Cloverleaf model) | >WENV180042503 Arg CCT t ACCA tgataatggg G - C C - G C - G C - G C - G C - G G - C T T T C G T C C A T G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A GTGC T T A - T G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |