Sequence ID | >WENV180042510 |
Genome ID | LQAF01000663 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3687 |
End posion on genome | 3762 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caagggttgt |
tRNA gene sequence |
TCCCTGATAGCTCAGTTGGTAGAGCAGTAGACTGTTAATCTATTGGTCGCTGGTTCGAGT |
Downstream region at tRNA end position |
aaacataatt |
Secondary structure (Cloverleaf model) | >WENV180042510 Asn GTT t GCCA aaacataatt T - A C - G C - G C - G T + G G - C A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A A - T G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |