Sequence ID | >WENV180042513 |
Genome ID | LQAF01000688 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 4401 |
End posion on genome | 4477 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgatccagac |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCAAA |
Downstream region at tRNA end position |
gaaaatcata |
Secondary structure (Cloverleaf model) | >WENV180042513 Pro TGG c ACCA gaaaatcata C - G G - C G - C G - C G - C C - G G - C T A T C T C T C A T G A A | + | | | A C C G C G G G G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |