Sequence ID | >WENV180042541 |
Genome ID | LQAF01002983 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1249 |
End posion on genome | 1174 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cacacgccgt |
tRNA gene sequence |
GGGGCTGTAGCTCAGCTGGGAGAGCGCTTGAATGGCATTCAAGAGGTCGTCAGTTCGATC |
Downstream region at tRNA end position |
ctaaaaatag |
Secondary structure (Cloverleaf model) | >WENV180042541 Ala GGC t ACCA ctaaaaatag G - C G - C G + T G - C C - G T - A G - C C T T T A G T C A C G A A + | | | | G T C T C G G T C A G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |