Sequence ID | >WENV180042573 |
Genome ID | LQAF01007068 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 98 |
End posion on genome | 173 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gccattattt |
tRNA gene sequence |
GACCCATTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
caacaacttc |
Secondary structure (Cloverleaf model) | >WENV180042573 Lys TTT t ACCA caacaacttc G - C A - T C - G C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G T C T C G C C G C G C G | | | | T T G G A G C T A A GTGTC T + G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |