Sequence ID | >WENV180042645 |
Genome ID | LQAF01016564 |
Phylum/Class | [LQAF] bioreactor metagenome; bioreactor_2 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 54 |
End posion on genome | 129 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caccccgggt |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCATCAGTTCGATC |
Downstream region at tRNA end position |
tttttacaat |
Secondary structure (Cloverleaf model) | >WENV180042645 Ala TGC t ACCA tttttacaat G - C G - C G + T G - C G - C T - A G - C C T T T T G T C A C G A A | | | | G T C T C G A T C A G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |