Sequence ID | >WENV180042681 |
Genome ID | LQAG01000069 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 16504 |
End posion on genome | 16429 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atagaaaatc |
tRNA gene sequence |
GGGCGAATAGCTCAGCTGGGAGAGCGCCTGCCTTACAAGCAGGATGTCGGGGGTTCGAGC |
Downstream region at tRNA end position |
gaaaaaagtt |
Secondary structure (Cloverleaf model) | >WENV180042681 Val TAC c ACCA gaaaaaagtt G - C G - C G - C C - G G - C A - T A - T C G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |