Sequence ID | >WENV180042685 |
Genome ID | LQAG01000080 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 28795 |
End posion on genome | 28720 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacacgttat |
tRNA gene sequence |
TCCCTTTTAGCTCAGTTGGTAGAGCATCTGACTGTTAATCAGATTGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
ttaaaatcag |
Secondary structure (Cloverleaf model) | >WENV180042685 Asn GTT t GCCA ttaaaatcag T - A C - G C - G C - G T - A T - A T - A C G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TTGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |