Sequence ID | >WENV180042687 |
Genome ID | LQAG01000083 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 28536 |
End posion on genome | 28460 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctgcctccgt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCGCTTGGTTTGGGACCAAGATGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
aagcaaaaat |
Secondary structure (Cloverleaf model) | >WENV180042687 Pro TGG t ACCA aagcaaaaat C - G G - C G - C A - T G - C C - G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A G ATGTC C - G T - A T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |