Sequence ID | >WENV180042703 |
Genome ID | LQAG01000131 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 16638 |
End posion on genome | 16711 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggcgcttgat |
tRNA gene sequence |
GGCCCCGTCGCCAAGTGGTAAGGCAGAGGTCTGCAACACCTTTATCAGCAGTTCGAATCT |
Downstream region at tRNA end position |
tcaataaatc |
Secondary structure (Cloverleaf model) | >WENV180042703 Cys GCA t TCCA tcaataaatc G - C G - C C - G C - G C - G C - G G - C T A T T C G T C A G A C | | | | | G T A C C G A G C A G C G | | | T T G A G G C T A A TATC G + T A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |