Sequence ID | >WENV180042740 |
Genome ID | LQAG01000351 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1811 |
End posion on genome | 1725 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acaagccttt |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGTAGACACGCCATCTTGAGGGGGTGGTGACCAATTGGTCGTG |
Downstream region at tRNA end position |
gaatttaagg |
Secondary structure (Cloverleaf model) | >WENV180042740 Leu GAG t ACCA gaatttaagg G - C C - G C - G G - C A - T A - T G - C T G T C G C T C A C A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGACCAATTGGTCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |