Sequence ID | >WENV180042769 |
Genome ID | LQAG01000540 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 6537 |
End posion on genome | 6613 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcttcccttt |
tRNA gene sequence |
GCGCCGCTAGCTCAGCTGGATAGAGCGTCTGACTACGGATCAGAAGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tttaatatta |
Secondary structure (Cloverleaf model) | >WENV180042769 Arg ACG t GCCA tttaatatta G - C C - G G - C C - G C - G G - C C - G T A T C C T T C A C G A A | | + | | G T C T C G G G G A G C G | | | | T T G G A G C A T A G AGGTC T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |