Sequence ID | >WENV180042774 |
Genome ID | LQAG01000596 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3006 |
End posion on genome | 3080 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tttttgctga |
tRNA gene sequence |
GCGGGAATAACTCAGTGGTAGAGTGCGACCTTGCCAAGGTCGAAGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ttctttcttt |
Secondary structure (Cloverleaf model) | >WENV180042774 Gly GCC a TCCA ttctttcttt G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A G A A + | | | | A T C T C A G C G G G C G | | | | T T G G A G T T A G AAGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |