Sequence ID | >WENV180042776 |
Genome ID | LQAG01000628 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 5989 |
End posion on genome | 6076 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttaaatct |
tRNA gene sequence |
GGAGGAGTGGCCGAGCGGCTGAAGGCGGCGGTCTTGAAAACCGTTAAGTGTAACAGCTTC |
Downstream region at tRNA end position |
tgaaatcagc |
Secondary structure (Cloverleaf model) | >WENV180042776 Ser TGA t GCCA tgaaatcagc G - C G - C A - T G - C G - C A - T G - C T A T C A T C C A C G A G | | + | | G G G C C G G T G G G C G | | | T T C A G G C T G A G TAAGTGTAACAGCTTC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |