Sequence ID | >WENV180042777 |
Genome ID | LQAG01000629 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 5487 |
End posion on genome | 5413 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aaacggctaa |
tRNA gene sequence |
GGGCGGTTAACTCAGCGGGAGAGTGCTACCTTCACACGGTAGAAGTCACAAGTTCAATCC |
Downstream region at tRNA end position |
tttattaaat |
Secondary structure (Cloverleaf model) | >WENV180042777 Val CAC a ACCA tttattaaat G - C G - C G - C C - G G - C G - C T - A C T T T G T T C A G A A | | | | | A C C T C A A C A A G C G | | | | T T G G A G T G A G AAGTC C - G T - A A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |