Sequence ID | >WENV180042786 |
Genome ID | LQAG01000700 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3634 |
End posion on genome | 3558 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gtgtggatgt |
tRNA gene sequence |
GGGCTAGTAGCTCAGCTGGCTAGAGCACACGACTGATAATCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
gatcaattcg |
Secondary structure (Cloverleaf model) | >WENV180042786 Ile GAT t ACCA gatcaattcg G - C G - C G - C C - G T + G A - T G - C T G T C C T C C A C G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C C T A A AGGTC C - G A - T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |