Sequence ID | >WENV180042795 |
Genome ID | LQAG01000764 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2178 |
End posion on genome | 2264 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
caacagatgt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCACTAGTTTCAGGGACTAGCGAGCGTACGCTTGTG |
Downstream region at tRNA end position |
tcttccttct |
Secondary structure (Cloverleaf model) | >WENV180042795 Leu CAG t ACCA tcttccttct G - C C - G C - G G - C A - T A - T G - C T A T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G A CGAGCGTACGCTTGT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |