Sequence ID | >WENV180042803 |
Genome ID | LQAG01000991 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 308 |
End posion on genome | 211 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
aatggaatac |
tRNA gene sequence |
GGAAGTGCGCGGCTCACTGGTGGGGCCCTCGGACTTCAAATCCGATGTGGGGCGTTAATA |
Downstream region at tRNA end position |
cttctttaat |
Secondary structure (Cloverleaf model) | >WENV180042803 SeC TCA c GCCA cttctttaat G - C G - C A - T A - T G - C T - A G - C C - G T T G T A C C C A C A C C + | | | | G T T C G G G T G G G C G + | | | T T G G G C C T G G C TGTGGGGCGTTAATACCGTCCCGG T - A C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |