Sequence ID | >WENV180042805 |
Genome ID | LQAG01001009 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1275 |
End posion on genome | 1185 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aattgactgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGCGGCTGAAGGTGCACGCCTGGAAAGCGTGTGTATCCTAACCGGGT |
Downstream region at tRNA end position |
tattcccctt |
Secondary structure (Cloverleaf model) | >WENV180042805 Ser GGA c GCCA tattcccctt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | G G G C C G G A G G G C G | | + T T C A G G T T G A G TGTATCCTAACCGGGTACC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |