Sequence ID | >WENV180042844 |
Genome ID | LQAG01004622 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 25 |
End posion on genome | 101 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ggtcttatgg |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTTGACTACGAATCAAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
caaacaaatg |
Secondary structure (Cloverleaf model) | >WENV180042844 Arg ACG g GCCA caaacaaatg G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |