Sequence ID | >WENV180042895 |
Genome ID | LQAG01012281 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 80 |
End posion on genome | 155 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcttcccggc |
tRNA gene sequence |
GCTGGCGTAGCTCAATTGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGCGGGTTCAAGT |
Downstream region at tRNA end position |
tagacaaaat |
Secondary structure (Cloverleaf model) | >WENV180042895 Thr TGT c TCCA tagacaaaat G - C C - G T - A G - C G - C C - G G - C T G T T A C C C A T A A A + | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |