Sequence ID | >WENV180042908 |
Genome ID | LQAG01012872 |
Phylum/Class | [LQAG] bioreactor metagenome; bioreactor_3 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 111 |
End posion on genome | 186 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctcggaacac |
tRNA gene sequence |
GGGTCGTTAACTCAGTTGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
atccgtcccc |
Secondary structure (Cloverleaf model) | >WENV180042908 Lys TTT c ACCA atccgtcccc G - C G - C G - C T - A C - G G - C T - A C G T T G A C C A T G A A | | | | | G T C T C A A C T G G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |