Sequence ID | >WENV180042934 |
Genome ID | LQAH01000009 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 133630 |
End posion on genome | 133555 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ccacctgtaa |
tRNA gene sequence |
GGGGCTGTAGCTCAGTTGGGAGAGCGTTTGACTGGCAGTCAAAAGGTCCGCGGTTCGATC |
Downstream region at tRNA end position |
agaattcaag |
Secondary structure (Cloverleaf model) | >WENV180042934 Ala GGC a ACCA agaattcaag G - C G - C G + T G - C C - G T - A G + T C T T G C G C C A T G A A | | | | | G T C T C G C G C G G C G | | | | T T G G A G C G A G AGGTC T - A T - A T - A G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |