Sequence ID | >WENV180042935 |
Genome ID | LQAH01000009 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 129475 |
End posion on genome | 129390 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
accgactcat |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGTCGGTCTCAAAAACCGATGCCCTCCGGGCGTGC |
Downstream region at tRNA end position |
acaggcatga |
Secondary structure (Cloverleaf model) | >WENV180042935 Leu CAA t ACCA acaggcatga G + T C - G C - G G - C A - T A - T G - C T T T C G G C C A T A A G | | | | | G T G G T G G C C G G C G | | | T T G A C A C T A G G TGCCCTCCGGGCGT T - A C - G G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |