Sequence ID | >WENV180042938 |
Genome ID | LQAH01000010 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 107306 |
End posion on genome | 107219 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cggaattcgc |
tRNA gene sequence |
GGAGAGGTGACCGAGAGGCCGATGGTGCTCGCCTGGAAAGCGGGTGTAGTGAAAGCTACC |
Downstream region at tRNA end position |
taataacgaa |
Secondary structure (Cloverleaf model) | >WENV180042938 Ser GGA c GCCA taataacgaa G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A A G A G | | | | | G G G C C A G G G G G C G + | | | T T C T G G T C G A G TGTAGTGAAAGCTACC C - G T + G C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |