Sequence ID | >WENV180042946 |
Genome ID | LQAH01000014 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 74489 |
End posion on genome | 74405 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcttttatac |
tRNA gene sequence |
GCGAGAGTGGCGGAATTGGTAGACGCGCTGGTCTTAGGAACCAGTATCCTATGATGTGGG |
Downstream region at tRNA end position |
atcaaatcaa |
Secondary structure (Cloverleaf model) | >WENV180042946 Leu TAG c ACCA atcaaatcaa G - C C - G G - C A - T G - C A - T G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TATCCTATGATGT C - G T - A G - C G - C T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |