Sequence ID | >WENV180042960 |
Genome ID | LQAH01000024 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 103087 |
End posion on genome | 103162 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agcttgtcgg |
tRNA gene sequence |
GCCCACATAGCTCAGTCGGTAGAGCGCATCCTTGGTAAGGATGAGGTCACCAGTTCAAAT |
Downstream region at tRNA end position |
gttagttttt |
Secondary structure (Cloverleaf model) | >WENV180042960 Thr GGT g TCCA gttagttttt G - C C - G C - G C - G A - T C - G A - T T A T T G G T C A T G A A | | | | | A C C T C G A C C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |