Sequence ID | >WENV180042973 |
Genome ID | LQAH01000044 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 34296 |
End posion on genome | 34373 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gatattttaa |
tRNA gene sequence |
GTCCCTATCGTCTAGCCTGGCCCAGGACACCGCCCTTTCACGGCGGCGACGGGGGTTCGA |
Downstream region at tRNA end position |
actaaagaaa |
Secondary structure (Cloverleaf model) | >WENV180042973 Glu TTC a GCCA actaaagaaa G - C T - A C - G C - G C - G T + G A - T T A T C C C C C A C C G A C | | | | | G T T C T G G G G G G C G + | | | T T G G G A C C C C A A CGAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |