Sequence ID | >WENV180042987 |
Genome ID | LQAH01000073 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 32586 |
End posion on genome | 32673 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttgaataaat |
tRNA gene sequence |
GGAGAGGTGTCCGAGAGGCCGAAGGTGACAGACTCGAAATCTGTTGTGGCGCAAGCCACC |
Downstream region at tRNA end position |
taaactaaag |
Secondary structure (Cloverleaf model) | >WENV180042987 Ser CGA t GCCA taaactaaag G - C G - C A - T G - C A - T G - C G - C T A T C C C T C A A G A G | | | | | G G G C C T G G G A G C G | | T T C A G G T C G A G TGTGGCGCAAGCCACC A - T C - G A - T G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |