Sequence ID | >WENV180042998 |
Genome ID | LQAH01000127 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2599 |
End posion on genome | 2526 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gatttcaaaa |
tRNA gene sequence |
GGGGGTGTAGCTCAGTCGGCTAGAGCGCGTGAATGGCATTCACGAGGCCGCGGGTTCGAT |
Downstream region at tRNA end position |
taatataaaa |
Secondary structure (Cloverleaf model) | >WENV180042998 Ala GGC a Agga taatataaaa G - C G - C G + T G - C G - C T - A G - C T T T C A C C C A T G A A | | | | G C C T C G G C G G G C G | | | | T T G G A G C C T A G AGGCC C - G G - C T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |