Sequence ID | >WENV180043026 |
Genome ID | LQAH01000302 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3361 |
End posion on genome | 3436 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaaagcccat |
tRNA gene sequence |
GCCGGCGTAACTCAGGTGGTAGAGTAGCTGATTCGTAATCAGCAAGTCAGCAGTTCGAGT |
Downstream region at tRNA end position |
gcaaaattaa |
Secondary structure (Cloverleaf model) | >WENV180043026 Thr CGT t TCCA gcaaaattaa G - C C - G C - G G - C G - C C - G G - C T G T T C G T C A G G A A | | | | | G T C T C A A G C A G C G | | | | T T G G A G T T A A AAGTC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |