Sequence ID | >WENV180043040 |
Genome ID | LQAH01000534 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 4991 |
End posion on genome | 4918 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctccattcaa |
tRNA gene sequence |
GGCGGCTTGGCCAAGGGGTAAGGCAACGGCCTGCAAAGCCGATATCCCCGGTTCGAATCC |
Downstream region at tRNA end position |
tcatgaagtc |
Secondary structure (Cloverleaf model) | >WENV180043040 Cys GCA a TCCA tcatgaagtc G - C G - C C - G G - C G - C C - G T - A T A T G G G C C A G A G | | | | | G G A C C G C C C G G C G | | | T T G A G G C T A A TATC A A C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |