Sequence ID | >WENV180043065 |
Genome ID | LQAH01000808 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 337 |
End posion on genome | 263 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atctagataT |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
gtaaatcaga |
Secondary structure (Cloverleaf model) | >WENV180043065 Phe GAA T AGtt gtaaatcaga G - C C - G C - G C - G A - T G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |