Sequence ID | >WENV180043087 |
Genome ID | LQAH01001742 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2315 |
End posion on genome | 2389 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gaccggaaat |
tRNA gene sequence |
GGGTGATTAGCTCAGCGGTAGAGCACTTCGTTGACATCGAAGGGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
tgaattcact |
Secondary structure (Cloverleaf model) | >WENV180043087 Val GAC t ACCA tgaattcact G - C G - C G - C T + G G - C A - T T - A C T T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |