Sequence ID | >WENV180043090 |
Genome ID | LQAH01001848 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1354 |
End posion on genome | 1426 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
cttatcctga |
tRNA gene sequence |
TGCGGGGTAGAGCAGTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCCTTGGTTCGAATC |
Downstream region at tRNA end position |
aaaaaccgtc |
Secondary structure (Cloverleaf model) | >WENV180043090 fMet CAT a ACta aaaaaccgtc T T G - C C - G G - C G - C G - C G - C T A T G A A C C A G A A | | | | | G T C G A G C T T G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |