Sequence ID | >WENV180043091 |
Genome ID | LQAH01001857 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 905 |
End posion on genome | 981 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ctacaaggta |
tRNA gene sequence |
GGGCCTGTAGCTCAATTGGTTAGAGCAGAGCGCTCATAACGCTTTGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
aaaaccacga |
Secondary structure (Cloverleaf model) | >WENV180043091 Ile2 CAT a ACCA aaaaccacga G + T G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTT G + T A - T G - C C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |