Sequence ID | >WENV180043123 |
Genome ID | LQAH01003025 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 273 |
End posion on genome | 349 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tgttttgatt |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTAGCGCACTTGTCTGGGGGACAAGTGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
ttgagaataa |
Secondary structure (Cloverleaf model) | >WENV180043123 Pro GGG t ACCA ttgagaataa C - G G - C G - C G - C G + T C - G G - C T A T C G A C C A T G A A | | | | | A C C G C G G C T G G C T | | | | T T G G C G C G T A A TGGTC C - G T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |