Sequence ID | >WENV180043126 |
Genome ID | LQAH01003278 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2276 |
End posion on genome | 2351 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttatcgttaa |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCTTCAGCCTTCCAAGCTGAATGTCGCGAGTTCGAGC |
Downstream region at tRNA end position |
gccatcaaag |
Secondary structure (Cloverleaf model) | >WENV180043126 Gly TCC a TCCA gccatcaaag G - C C - G G - C G - C G - C A - T G - C C G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A T ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |