Sequence ID | >WENV180043175 |
Genome ID | LQAH01006195 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1027 |
End posion on genome | 940 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttacttccgt |
tRNA gene sequence |
GCCGGGATGGTGGAATTGGTAGACACCCGAGACTTAAAATCTCGTAATCCTTGCGATTGT |
Downstream region at tRNA end position |
gatagaataa |
Secondary structure (Cloverleaf model) | >WENV180043175 Leu TAA t ACCA gatagaataa G + T C - G C - G G - C G - C G - C A - T T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G C TAATCCTTGCGATTGT C - G G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |