Sequence ID | >WENV180043211 |
Genome ID | LQAH01010716 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 715 |
End posion on genome | 641 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttaaaacac |
tRNA gene sequence |
GGCGAGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCCCGAGTTCAAT |
Downstream region at tRNA end position |
tttaagtctg |
Secondary structure (Cloverleaf model) | >WENV180043211 Met CAT c ACtc tttaagtctg G + T G - C C - G G - C A - T G - C G + T T T T G G C T C A T G A A | | | | | A T C T C G C C G A G C G | | | | T T G G A G C T T A G AGGTC T + G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |