Sequence ID | >WENV180043237 |
Genome ID | LQAH01013761 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 556 |
End posion on genome | 631 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgagacatgc |
tRNA gene sequence |
TCCCCAGTAGCTCAGTTGGCAGAGCAATTGGCTGTTAACCAATGGGTCCGCGGTTCAAGT |
Downstream region at tRNA end position |
actaaataaa |
Secondary structure (Cloverleaf model) | >WENV180043237 Asn GTT c GCCA actaaataaa T - A C - G C - G C - G C - G A - T G - C T G T G T G C C A T G A A | + | | | A T C T C G C G C G G C G | | | | T T G G A G C C A A GGGTC A - T T - A T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |