Sequence ID | >WENV180043253 |
Genome ID | LQAH01015955 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 558 |
End posion on genome | 488 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaaaacatat |
tRNA gene sequence |
GGCGCCATAGCCAAGTGGTAAGGCAGAGGTCTGCAACACCTTCATCACCAGTTCAAATCT |
Downstream region at tRNA end position |
caactaacgc |
Secondary structure (Cloverleaf model) | >WENV180043253 Cys GCA t Ttaa caactaacgc G - C G - C C - G G - C C - G C - G A - T T A T T G G T C A G A A | | | | | A T A C C G A C C A G C G | | | T T G A G G C T A A CATC G + T A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |