Sequence ID | >WENV180043257 |
Genome ID | LQAH01016867 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 11 |
End posion on genome | 87 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttcttcacgc |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGATAGAGTGCCGGACTACGAATCCGTAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
cttagagaat |
Secondary structure (Cloverleaf model) | >WENV180043257 Arg ACG c GCCA cttagagaat G - C C - G G - C C - G C - G T - A G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | + T T G G A G T A T A G AGGTC C T C - G G - C G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |