Sequence ID | >WENV180043270 |
Genome ID | LQAH01019091 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 477 |
End posion on genome | 552 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcggcctttc |
tRNA gene sequence |
GGCTAGGTAGCTCAGTTGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
cttttctttt |
Secondary structure (Cloverleaf model) | >WENV180043270 Phe GAA c ACCA cttttctttt G - C G - C C - G T + G A - T G - C G - C T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |