Sequence ID | >WENV180043293 |
Genome ID | LQAH01024933 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 325 |
End posion on genome | 250 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aataaaggat |
tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCAAGT |
Downstream region at tRNA end position |
tacatttgtg |
Secondary structure (Cloverleaf model) | >WENV180043293 Thr GGT t TCCA tacatttgtg G - C C - G C - G C - G A - T C - G G - C T G T T G G C C A T G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |