Sequence ID | >WENV180043295 |
Genome ID | LQAH01025004 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 373 |
End posion on genome | 302 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaacacacaa |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
attttttttg |
Secondary structure (Cloverleaf model) | >WENV180043295 Glu TTC a Attt attttttttg G - C G + T C - G C - G C - G G - C T - A T T T T C C C C A C G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |