Sequence ID | >WENV180043309 |
Genome ID | LQAH01027388 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 227 |
End posion on genome | 154 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggcggctttt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACTTCAGCCTTCCAAGCTGACTACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tataatgagt |
Secondary structure (Cloverleaf model) | >WENV180043309 Gly TCC t TCCA tataatgagt G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A T CTAC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |